Skip to main content

Table 1 Primers used in fragment analysis

From: HNPCC versus sporadic microsatellite-unstable colon cancers follow different routes toward loss of HLA class I expression

Gene Forward primer Reverse primer Microsatellite Repeat
HLA A 4th ex CCTGAATTTTCTGACTCTTCCCGT GTTTCTTTCCCGCTGCCAGGTCAGTGT 7(C)
HLA A 5th ex CCATCGTGGGCATCATTG GTTTCTTTCAGTGAGACAAGAAATCTC 3(GGA)
HLA B 2nd ex GCTTCATCTCAGTGGGCTAC GTTTCTTCTCGCTCTGGTTGTA 3(GA) + 3(CA)
β2m 1st ex GGCTGGGCACGCGTTTAAT GTTTCTTAGGGAGAGAAGGACCAGAG 4(CT)
β2m 2nd ex (1) TACCCTGGCAATATTAATGTG GTTTCTTGATAGAAAGACCAGTCCTTGC 4(GA) + 5(A)
β2m 2nd ex (2) CTTACTGAAGAATGGAGAGAG GTTTCTTGACTACTCATACACAACTTTCA 5(A)
TAP1 1st ex TAAATGGCTGAGCTTCTCGC GTTTCTTAGAGCTAGCCATTGGCA 5(C)
TAP1 3rd ex ACAGCCACTTGCAGGGAG GTTTCTTTATGAACAGTACATGGCGTAT 5(T)
TAP1 8th ex CTGCCCTGCTGCAGAATCTG GTTTCTTCAAGCCACCTGCTTCCAT 5(G)
TAP1 10th ex CTCTGCAGAGGTAGACGAGG GTTTCTTATTAAGAAGATGACTGCCTCAC 5(G)
TAP1 11th ex AGCACCTCAGCCTGGTGGA GTTTCTTGCAGGTCTGAGAAGGCTTTC 6(G) + 5(A)
TAP2 2nd ex TTCCTCAAGGGCTGCCAGGAC GTTTCTTGCTCCAAGGGGCTGAAG 6(C)
TAP2 9th ex CCTACGTCCTGGTGAGGTGA GTTTCTTCTGGCTGTGCAGGTAGC 5(G)
Tapasin 2nd ex TTGGTTCGTGGAGGATGC GTTTCTTCCTAGAGACTCACCGTGTAC 5(G)
Tapasin 3rd ex CTTCCTTCTCTACACTCAGACC GTTTCTTAGGACTGGGCTGGATATGC 5(C)
Tapasin 4th ex CCTGTCTTCCTCAGTGGTAC GTTTCTTGAGCAGATGTCCCTTACCC 6(C)
Tapasin 5th ex TGCTCATTTCGTCCTCTTTCC GTTTCTTGTTCCCACTCCACCTCCAG 5(G)
Calnexin 7th ex GAAGGATCAGTTCCATGACAAG GTTTCTTCTGCATCTGGCCTCTTAGC 5(A)
Calnexin 8th ex TCTGCTCAATGACATGACTCC GTTTCTTTGAAGACAGTTCCCCAAGAC 5(A)
Calnexin 11th ex AACCTTTCAGAATGACTCCTTTTAG GTTTCTTCAAGCAGCAAACACGAACC 8(T)
Calreticulin 3rd ex CTACCGTCCCGTCTCAGG GTTTCTTTCTGTCTGGTCCAAACTATTAGG 5(G)
Calreticulin 6th ex GACAAGCCCGAGCATATCC GTTTCTTCACCTTGTACTCAGGGTTCTG 5(C)
ERp57 5th ex CACTTATTGCTTCTTCCTTGTG GTTTCTTAATACTTGGTCAGGAGATTCAAC 6(T)
ERp57 6th ex CTTCTGCTATCTGCCTACTGAG GTTTCTTTCAAGCAAATAAATCCCAGACAAG 6(A)
ERp57 13th ex ACTTTTAAGCTGATCTTTCTGTTTT GTTTCTTTTAGAGATCCTCCTGTGCCTT 6(C)
LMP2 2nd ex GAGGGCATCAAGGCTGTTC GTTTCTTGCAGACACTCGGGAATCAG 5(G)
LMP2 6th ex CCCTCTCTCCAACTTGAAACC GTTTCTTTGTAATAGTGACCAGGTAGATGAC 5(G)
LMP7 1st ex GGCTTTCGCTTTCACTTCC GTTTCTTGAGATCGCATAGAGAAACTGTAG 6(C)