Skip to main content

Table 1 Real-time PCR primers and probes used in this study

From: Fenretinide-induced apoptosis of Huh-7 hepatocellular carcinoma is retinoic acid receptor β dependent

Target Gene Gene Bank Acession NO.   Primer Sequence (5'-3') Sequences are shown for forward (F) and reverse (R) primers Probe Sequence (5'-3')with modification of 5' FAM/3' BHQ1
hRARα NM_000964 F GACAAGTCCTCAGGCTACCACTATG CTGCAAGGGCTTCTTCCGCCG
   R GTACACCATGTTCTTCTGGATGCT  
hRARβ NM_000965 F TCTCAGTGCCATCTGCTTAATCTG CCAGGACCTTGAGGAACCGACAAAAG
   R CCAGCAATGGTTCTTGTAGCTTATC  
hRARγ NM_000966 F GCTGCAAGGGCTTCTTTCG CGAAGCATCCAGAAGAACATGGTGTAC
   R CAGTTTTTGTCGCGGTGACA  
hRXRα NM_002957 F TCCTTGGAGGCCTACTGCAA CAGCCGGGAAGGTTCGCTAAGC
   R GCATTTGAGCCCGATGGA  
hRXRβ NM_021976 F AGCAGCAGGGACGGTTTG AAGCTGCTGCTACGTCTTCCTGCCC
   R GCTCTAGACACTTAAGGCCAATGG  
hRXRγ NM_006917 F ACCTTGGAGGACCAGGTCATT TGCTTCGGGCAGGGTGGAATG
   R GGAGAAAGAGGCAATCAGCAA  
hNur77 NM_002135 F AGCATTATGGTGTCCGCACAT TGAGGGCTGCAAGGGCTTCTTCAA
   R TTGGCGTTTTTCTGCACTGT  
hNurr1 NM_006186 F TGGGATGGTCAAAGAAGTGGTT TTTAAAAGGCCGGAGAGGTCGTTTGC
   R TGGGCTCTTCGGTTTCGA  
hNOR1 NM_006981 F ATGCCCTTGTCCGAGCTTT AACACCCAGAGATCTTGATTATTCCAGA
   R AGCCTGGTCAGTGGGACAGT  
hCAR NM_005122 F CACATGGGCACCATGTTTGA TTTGTGCAGTTTAGGCCTCCAGCTCATCT
   R AAGGGCTGGTGATGGATGAA  
SXR NM_003889 F TCCCCAAATCTGCCGTGTAT ACAAGGCCACTGGCTATCACTTCAATGTCA
   R AGCCCTTGCATCCTTCACAT  
hPPARα NM_005036 F AGCTCCCGTATCTTTTGTTATGTTG GTCTGCGCTCCAGAGAGCATCTACTGTCA
   R TCGATCCGCAGGGTGACT  
hβ-Actin NM_001101 F CCTGGCACCCAGCACAAT ATCAAGATCATTGCTCCTCCTGAGCGC
   R GCCGATCCACACGGAGTACT