Skip to main content

Table 2 TP53 sequencing primers and annealing temperature conditions

From: High resolution melting for mutation scanning of TP53exons 5–8

Exon Primer name Sequence Annealing temperature
5 TP53_5F CTCTGTCTCCTTCCTCTTCC 55°C
  TP53_5R GCAATCAGTGAGGAATCAGAGG  
6 TP53_6F AGATAGCGATGGTGAGCAGC 60°C
  TP53_6R ACTGACAACCACCCTTAACC  
7 TP53_7F CAGGTCTCCCCAAGGCGCAC 60°C
  TP53_7R GCAAGCAGAGGCTGGGGCAC  
8 TP53_8F GGAGTAGATGGAGCCTGGTT 58°C
  TP53_8R GTGAATCTGAGGCATAACTG