Skip to main content

Table 1 TP53 HRM primers and PCR annealing temperature conditions

From: High resolution melting for mutation scanning of TP53exons 5–8

Exon Primer name Sequence Annealing conditions
5a TP53_Exon5a_F CAACTCTGTCTCCTTCCTCTTCCTAC 65–60°C touchdown 0.5°C/cycle for 10 cycles
  TP53_Exon5a_R AGCCATGGCACGGACGCG  
5b TP53_Exon5b_F CTCCTGCCCGGCACCCGC 65–60°C touchdown 0.5°C/cycle for 10 cycles
  TP53_Exon5b_R CTAAGAGCAATCAGTGAGGAATCAGA  
6 TP53_Exon6_F CAACCACCCTTAACCCCTCCT 68–58°C touchdown 1.0°C/cycle for 10 cycles
  TP53_Exon6_R AGACGACAGGGCTGGTTGC  
7 TP53_Exon7_F AGGCGCACTGGCCTCATC 68–58°C touchdown 1.0°C/cycle for 10 cycles
  TP53_Exon7_R GAGGCTGGGGCACAGCA  
8 TP53_Exon8_F GACCTGATTTCCTTACTGCCTCTTG 63.5–58.5°C touchdown 0.5°C/cycle for 10 cycles
  TP53_Exon8_R AATCTGAGGCATAACTGCACCCTT  
  1. Underlined nucleotides are introduced sequence