Correlations of EGFR mutations and increases in EGFR and HER2 copy number to gefitinib response in a retrospective analysis of lung cancer patients

Table 1 PCR primers for 7 exons of the EGFR tyrosine kinase domain

Exon	Annealing Temperature, °C (T_ann)	Forward Primer Sequence	Reverse Primer Sequence	Product Length (with seq tags)
18	60	gtgtcctggcacccaagc	ccccaccagaccatgaga	340
19	60	cagcatgtggcaccatctc	cagagcagctgccagacat	273
20	60	cattcatgcgtcttcacctg	catatccccatggcaaactc	412
21	60	agccataagtcctcgacgtg	acccagaatgtctggagagc	372
22	56	tccagagtgagttaactttttcca	ttgcatgtcagaggatataatgtaa	277
23	60	gaagcaaattgcccaagact	atttctccagggatgcaaag	413
24	56	gcaatgccatctttatcatttc	gctggcatgtgacagaacac	281

PCR primers were designed at least 40 bp from EGFR exons coding for the tyrosine kinase domain. Sequencing tags were added to each primer to allow sequencing of the PCR products. All forward primer sequences were prefixed with a -21M13 sequencing tag, TGTAAAACGACGGCCAGT. All reverse primer sequences were prefixed with an M13R sequencing tag, CAGGAAACAGCTATGAC. -21M13 and M13R sequencing primers were then used in the corresponding sequencing reaction to generate sequences from both strands of the PCR products.

ISSN: 1471-2407