Skip to main content

Table 1 PCR primers for 7 exons of the EGFR tyrosine kinase domain

From: Correlations of EGFR mutations and increases in EGFR and HER2 copy number to gefitinib response in a retrospective analysis of lung cancer patients

Exon Annealing Temperature, °C (Tann) Forward Primer Sequence Reverse Primer Sequence Product Length (with seq tags)
18 60 gtgtcctggcacccaagc ccccaccagaccatgaga 340
19 60 cagcatgtggcaccatctc cagagcagctgccagacat 273
20 60 cattcatgcgtcttcacctg catatccccatggcaaactc 412
21 60 agccataagtcctcgacgtg acccagaatgtctggagagc 372
22 56 tccagagtgagttaactttttcca ttgcatgtcagaggatataatgtaa 277
23 60 gaagcaaattgcccaagact atttctccagggatgcaaag 413
24 56 gcaatgccatctttatcatttc gctggcatgtgacagaacac 281
  1. PCR primers were designed at least 40 bp from EGFR exons coding for the tyrosine kinase domain. Sequencing tags were added to each primer to allow sequencing of the PCR products. All forward primer sequences were prefixed with a -21M13 sequencing tag, TGTAAAACGACGGCCAGT. All reverse primer sequences were prefixed with an M13R sequencing tag, CAGGAAACAGCTATGAC. -21M13 and M13R sequencing primers were then used in the corresponding sequencing reaction to generate sequences from both strands of the PCR products.