Skip to main content

Advertisement

Table 1 Sequences of primers used in the RT-PCR experiments.

From: Upregulation of meiosis-specific genes in lymphoma cell lines following genotoxic insult and induction of mitotic catastrophe

Gene Forward Reverse Primer
MOS 5'-CGGTGTTCCTGTGGCCATAA 5'-GCAGGCCGTTCACAACATC
REC8 5'-TGAGGGTGAATGTGGTGAAA 5'-CTGGGATTGCAGCCTCTAAG
SYCP3 5'- TGCAGAAAGCTGAGGAACAA 5'-TGCTGCTGAGTTTCCATCAT
SYCP1 5'- TGGCGATGTGATGGAATTTA 5'- TGTTTTCCCCATTTTTGGAG
SPO11 5'- AGGAAGATGGCACCAAAGTG 5'-GGTCCCTTTTTGTCAGTGGA
STAG3 5'- GGATGCAAAGCTACAGCA 5'- CATCCGGTCCTTGAAGC
DMC1 5'- AGCAGCAAAGTTCCATGAAG 5'- TGAGCTCTCCTCTTCCCTTT