Skip to main content

Table 1 Primers and amplification conditions of 8 selected putative genes

From: A transcriptome anatomy of human colorectal cancers

Gene Name Primers PCR Fragments (bp) Annealing Temperature(C) Cycles
TWISTNB ATAACATCAAAGTTGTGGGAGA 196 48 35
  TCAGGTTTAGGAATGGAGGC    
YPEL2 ATCGAAGACTTTCCAGGCATAT 344 57 36
  ATCAGTCCCAGCCATTGTCC    
YPEL5 TAAACCTGGAGACTCGGGTGG 205 59 35
  AGCGGTTGGTCAGGATCGTAT    
Sep6 AAGGTTGCCGAACTGTCC 280 59 36
  AAGCCAACTGTGCTAACGA    
Sep4 CGAAAGTCCGTGAAGAAAG 221 59 34
  GTGTCCACAATGGTGAGCC    
CBX3 ATAATTGGTGCCACAGACA 325 53 31
  AACAACTCTTCCAACGCTA    
SOX9 AGGTGCTCAAAGGCTACGACT 360 63 32
  AGATGTGCGTCTGCTCCGTG    
β-catenin TCTTGGCTATTACGACAG 459 58 32
  CCTCTATACCACCCACTT