Skip to main content

Advertisement

Table 3 Sequences of primers and PCR conditions used to screen BER genes.

From: Evaluation of NTHL1, NEIL1, NEIL2, MPG, TDG, UNG and SMUG1genes in familial colorectal cancer predisposition

   Primer sequence (5' > 3')   
Gene Fragment Forward Reverse Amplicon (bp) PCR Conditions*
NTHL1 1 GTAGTTCTGTGCCGCCCTCT CAGCCTGCAGCCCCTATC 270 68–60 TD, 1.7M B
  2A ATGAACGAGTGAGGGGTGAG AGCTGTTGCTGCCAGTCC 244 68–60 TD, 1.7M B
  2B AGAGACTGCGTGTGGCCTAT GAGGGTGCCAGCCAAAAG 284 68–60 TD, 1M B
  3 CAGGGAATCACCCAGGAC AGGTCTCTCTCAGGCCACTG 279 68–60 TD, 1M B
  4 GCTGCATCCTCCCAGGTT CACAGGTCACAAGGATGTGG 298 68–60 TD
  5 GGCTAGGCTGGTGGAGTGT GGGTCAGTGCTGACAGAGG 225 68–60 TD
  6 GGCTTCCTAGGGAGAAGAGC GTGGCTTCCTGAAGCGTAAA 266 68–60 TD
NEIL1 1A CAGCCGCTACCTCACAAAGT GCTGAAGCTGAGATGCGGTA 232 68–60 TD
  1B CAGCCAGTTTGTGAATGAGG CCGTGTAAAAGCGCAGGT 281 68–60 TD
  1C CCACTGGCCCTGGTCTTC TTGGCCAAGAAGGCACTAAG 295 68–60 TD, 1M B
  2 AGGTTCTCTGAGCCCCTCTC GCTAGGCAGTGGGGAATGT 263 68–60 TD
  3 GTGCCCACATTCCCCACT CTAAGCTGGGGACACCTGAC 208 68–60 TD
  4 CCCAAAGTCTGACCAAGCTC CCCCAGGGTTACACAATCAT 245 68–60 TD
  5 GAGCCTGCCCTCTGATCTCT GGGGTCTCTGCCTGTGTG 203 68–60 TD
  6 CACTGATCTGGATGGGTGTG ATAGGGTGGAGAAGGGTGCT 210 60–50 TD, 1M B
  7 AGCACCCTTCTCCACCCTAT CCGCCCTCTTAGGGTAAGG 238 68–60 TD
  8 CCAACCTCTGAACTGCTTTCT TAGAGCCAGTTTCTGGGAGTG 257 68–60 TD
  9 CGTGTACAAAGGTGGGAGAAA AATTCAGACCCCCAGATGC 216 68–60 TD
NEIL2 1 TGCTTGGCACCTGTTAAAGA CCCTGAGACATATGGGGATAGA 296 68–60 TD, 1M B
  2A AATATCCGCATTCCCCAGTT GGGCGTCTCTCTCCAAATAC 296 68–60 TD, 1M B
  2B GGGCAGAAGACCCTTGATG TGACTATCAGAGCCCACGAA 254 68–60 TD, 1M B
  3 CAGCCACAGGGTGTGCTCT TCTGTGGACTCACCCCTTTC 299 68–60 TD, 1M B
  4A GCCATGTGTCCTTTGTCCTT GCCTCTGTAACCCATCTTCG 290 68–60 TD, 1M B
  4B CGCAGCACACACAGGTCTAC CCACATCCTCCTTTCTGGAC 237 68–60 TD, 1M B
MPG 1 GGTCCTAGGGGTGCTTCC TGGCCTATGCTCTGGCTCT 254 68–60 TD, 1.7M B
  2A GCTGTCTCCTATTCGGATGC CCCTTTGGGCTTGAGAAATA 248 68–60 TD, 1.7M B
  2B CACACAGCTCGTCCGATG CAGTGACAGGCACTTCAGGA 229 68–60 TD, 1M B
  3A TGGGCACTGTTAGGGTGAGT ACCCTGGCTGGAGATGTTC 273 68–60 TD, 1M B
  3B CTAGTCCGGCGACTTCCTAA CCCCACCTCAGTCCTCCTA 291 68–60 TD, 1M B
  4A GCAGAGAGGACAGGAGCCTA CCAGCCATACAGCTTCATCC 267 68–60 TD, 1M B
  4B GAGACCATGCGTCAGCTTC ACATAGAAGCGGAGGGGTTT 266 68–60 TD, 1M B
  4C GATGAAGCTGTATGGCTGGAG GCTCTGGCTAAGGCACAGTT 270 68–60 TD, 1M B
TDG 1 TCTCTGGGGTTGTCTTACCG AGCCTGCCCAGCAGTGAG 180 68–60 TD, 1M B
  2 TGATCATTTGGATTTACATTTGG GGCTGATCCGATGTTGAACT 252 68–60 TD, 1M B
  3A TTTTCTGGGAAAGCTGCTAAA GGGGAGAGTCTTGGTCAGAA 279 60–50 TD
  3B CTGGCAAGTCTGCAAAATCA GGTCCTTTTCAGCAAAATGC 252 60–50 TD
  4 GATGAAATGTCTAATTGTTTTGTTTT CACACAGAACATGAAACACGA 233 60–50 TD
  5 GGCTGCACTGAGCCATGAT GGTTCCAACCCATAAAAGCA 271 68–50 TD
  6 TCAAGCTGAGCTCAACAAATG CAAACATATTTACATTGCCCATAA 262 68–60 TD
  7 TCAGCCACGAATAGCAGTGT TCACAATGGATAGGACAAATAAGG 288 68–60 TD
  8A CAAGTTATTAACCCAAATAAAGACAAA TGAATAAAAGGAATGAGGACAGTAA 300 60–50 TD, 1M B
  8B CATCCAGTGCAAGATGTGCT CACAAAATGAATAAAAGGAATGAGG 190 68–60 TD, 1M B
  9 CAAGAAAAAGAATTGTTCATGATTTC CCTGACCAAACCGTCTTTGA 267 68–60 TD
  10 GGCGATAGAGTAAGACCCAGTC GGTTCTACTTGTTGACAACTGCAT 298 68–60 TD
UNG 1 AATTGCTGACCGCCACAG CCTTCCTCCCCCTTCACC 262 68–60 TD, 1M B
  2A GGGCTCTTACTGTCCGCTTT CTCTGGATCCGGTCCAACT 240 68–60 TD, 1M B
  2B GACCACTTGCAGGCCATC GGCCGGCTACACTAACAAGA 296 68–60 TD, 1M B
  3 TTGAATTCTTATGGTTTCCAATGA TGTGGCTTAACTCCAGTGTCC 240 68–60 TD, 1M B
  4 CAGGGTCTGTGCTGCTTACA AACAGTGCCCCAGATAGTCC 251 68–60 TD, 1M B
  5A CAAGGGCTGGCTGTAACTTC TAGCAGTCGCTGGCTTACCT 218 68–60 TD, 1M B
  5B GGCTTGCTTTCAGTTTGGAG CAGCTATGGTGGCTCATGC 288 68–60 TD, 1M B
  6 TGCCTGAGCCTACATTTAACC GCAGGGACTCCTAGAATTCTTTA 299 60–50 TD, 1M B
  7 CCACTGCAGCAAGACTCTGT GGAACTTCGTAACTGGCAAA   60–50 TD
SMUG1 1A CTCTGTGGCTGAGGGTTGAT TTGTAGATGATGCCCACAGG 233 68–50 TD, 1M B
  1B AGAGCTTCCTGGAGGAGGAG AGCCAAGCATCCACCTAGAA 258 68–60 TD, 1M B
  2A TCTCCAGTTTGAAGCCTTTCAT CTCAGCAGGAGTAAGGTTGC 300 68–60 TD, 1M B
  2B CCACAATCTATGCCCTCTGC TCAATCTTTCCTTGGCCACT 296 68–60 TD, 1M B
  2C TCTTGGGATCTGTGATGCAG TTCGAGGTCTTGAATGTGTCC 286 68–60 TD, 1M B
  1. * TD, Touchdown °C; B, Betaine