Skip to main content

Table 1 Primer lists of Real-time PCR

From: Identification of genes associated with cisplatin resistance in human oral squamous cell carcinoma cell line

Gene Name Primer Sequence Product
MAP2K6 5' GAGTCTGGGCATCACG 3' 103bp
  5' CGATGGCTCCTCTACC 3'  
RECQL 5' CAATGGCTGGAAAGGAGGTA 3' 112bp
  5' AATGGGCAAATGACGAGTGT 3'  
CCND1 5' GCTGGAGCCCGTGAAAAAGAG 3' 326bp
  5' GGATTGGAAATGAACTTCACA 3'  
CCND3 5' CTGCCTCCAGGAACCACA 3' 146bp
  5' GCTTGACTAGCCACCGAAAT 3'  
ABCC1 5' AAATGCAGCTGATGAATCCAAAA 3' 271bp
  5' TTGCAAATGCTGGTTGCA 3'  
ABCC2 5' CACTTCAGCGAGACCG 3' 246bp
  5' GGACAGAACAAAGCCAAC 3'  
GST-pi 5' TTTCGCCGCCGCAGTCT 3' 122bp
  5' TCCACGGTCACCACCTCCTC 3'  
GAPDH 5' AACGGATTTGGTCGTATTGGG 3' 516bp
  5' AGTCTTCTGGGTGGCAGTGAT 3'