Skip to main content

Table 1 RT-PCR primer sequences and annealing temperatures for validation of microarray expression data.

From: Identification of genes regulated by Wnt/β-catenin pathway and involved in apoptosis via microarray analysis

Gene symbol PCR primer sequences Annealing (°C) PCR-based expression Chip-based expression
β-actin 1 st GGCGGCACCACCATGTACCCT 56 Control NA
  1. Genes marked "NA" were not included in the 130 differentially regulated genes (listed in Additional Table 2); "Down" and "Up" refer to the expression levels in induced vs. control cells.