Skip to main content

Advertisement

Table 1 RT-PCR primer sequences and annealing temperatures for validation of microarray expression data.

From: Identification of genes regulated by Wnt/β-catenin pathway and involved in apoptosis via microarray analysis

Gene symbol PCR primer sequences Annealing (°C) PCR-based expression Chip-based expression
CTNNB1 1 st CCTGGTGCTGACTATCCAGT 52 Down Down
  2nd ACTTCCACACATGATCACAT    
VEGF 1 st GAGGGCAGAATCATCACGAA 62 Down NA
  2nd AACGCTCCAGGACTTATACC    
Cox2 1 st CGAGGTGTATGTATGAGTGT 60 Down NA
  2nd AGGGAGTCGGGCAATC    
Id2 1 st CCGCTCGAGACCATGAAAGCCTTCAGTCCCGTGAGG 61 Down NA
  2nd CGGGATCCTTGCCACACAGTGCTTTGCTG    
Gastrin 1 st CGGAATTCACCATGCAGCGACTATGTG 58 Down NA
  2nd CGGGATCCATGTTCTCATCCTCAGCACT    
MMP7 1 st TGTTAAACTCCCGCGTCATA 58 Down NA
  2nd GCGTTCATCCTCATCGAAGT    
CD44 1 st CCATCCTCGTCCCGTCCT 56 Down NA
  2nd GCCCTTCTATGAACCCATACCT    
MYBL2 1 st CTCATCTTGTCCTGAGGTGT 56 Up Up
  2nd TGAGGCCAGGCCTGACGTG    
BAG3 1 st AGCCATCCTGGAGAAGGTAC 56 Up Up
  2nd GGCACCCATCTCCATGATTG    
PTEN 1 st CCACCACAGCTAGAACTTA 52 Up Up
  2nd CAACAGTGCCACTGGTCTA    
PDCD6IP 1 st CTCGGCTCTGTTAGTGTAAC 52 Up Up
  2nd CACTTCTGACTAGTTCCTCT    
HIF1A 1 st GATACCAACAGTAACCAACCT 52 Up Up
  2nd CCGGTTTAAGGACACATTCT    
BAG2 1 st GAAGATCTATGGCTCAGGCGAAGAT 56 Up Up
  2nd ATTTGCGGCCGCCTAATTGAATCTGCTTTCAGC    
DAP3 1 st CCTCCTAGTGGCCGTGGATG 56 Up Up
  2nd GCGTTACTTAGGAACAGCAG    
β-actin 1 st GGCGGCACCACCATGTACCCT 56 Control NA
  2nd AGGGGCCGGACTCGTCATACT    
  1. Genes marked "NA" were not included in the 130 differentially regulated genes (listed in Additional Table 2); "Down" and "Up" refer to the expression levels in induced vs. control cells.