Skip to main content

Advertisement

Table 1 Gene-specific primers used in semi-quantitative RT-PCR analysis

From: TSPY potentiates cell proliferation and tumorigenesis by promoting cell cycle progression in HeLa and NIH3T3 cells

Gene Primers Sequences
RGC32 Forward GAGCGCCACTTCCACTACG
  Reverse AGTGAATCTGCACTCTCCGAG
PDGFC Forward ACTCAGGCGGAATCCAACC
  Reverse CTTGGGCTGTGAATACTTCCATT
WNT5A Forward TTGGTGGTCGCTAGGTATGAA
  Reverse AGTGGCACAGTTTCTTCTGTC
CCND2 Forward AGGCGGTGCTCCTCAATAG
  Reverse TATCCCGCACGTCTGTAGGG
CUL1 Forward ACCAGTCAAACCAAGCACGAG
  Reverse GTCTGCCCCTTTTTCGACTTAG
IGFBP3 Forward AGAGCACAGATACCCAGAACT
  Reverse TGAGGAACTTCAGGTGATTCAGT
TIMP1 Forward CTTCTGCAATTCCGACCTCGT
  Reverse CCCTAAGGCTTGGAACCCTTT
SPARC Forward AGCACCCCATTGACGGGTA
  Reverse GGTCACAGGTCTCGAAAAAGC