Skip to main content

Advertisement

Table 1 Primers used in quantitative reverse transcriptase PCR

From: Over-expression of Eph and ephrin genes in advanced ovarian cancer: ephrin gene expression correlates with shortened survival

Gene (Acc. No.) Forward Primer (5' – 3') Reverse Primer (5' – 3')
18S rRNA (K03432) GACTCAACACGGGAAACCTC AGCATGCCAGAGTCTCGTTC
EphA1 (NM_005232) GTGGACACTGTCATAGGAGAAGG GGTCTTAATGGCCACAGTCTTG
EphA2 (NM_004431) GGGACCTGATGCAGAACATC AGTTGGTGCGGAGCCAGT
ephrin A1 (BC032698) CCGGAGAAGCTGTCTGAGAA GGTTTGGAGATGTAGTAGTAGCTGTG
ephrin A5 (NM_001962) TTGCACGTGGAGATGTTGAC GGTTGCTGCTGTTCCAGTAGA
EphB2 (NM_004442) GAAGGAGCTCAGTGAGTACAACG GCACCTGGAAGACATAGATGG
EphB3 (NM_004443) GGCCATAGCCTATCGGAAGT TCCCAGTAGGGTCGCTCTC
EphB6 (NM_004445) GAGCAGGAGGTACTAAATGCAA CCAGCTGGTCAAAATGAGG
ephrin B1 (BC052979) TGAAGGTTGGGCAAGATCC GGTTCACAGTCTCATGCTTGC
  1. Genbank Accession Numbers are listed in parenthesis.