Skip to main content

Table 1 Sequences of oligonucleotide primers

From: Differential expression of a new isoform of DLG2 in renal oncocytoma

PCR and sequencing primers
  Name Sequence 5'->3'
RT-PCR DLG2_spec1-F GATGACCCTGGCATATTTATTACGA
  DLG2_spec1-R ACGATAGACCCTGCTTCCTTCA
  DLG2_spec2-F TGGGGAACCAACACATTCCT
  DLG2_spec2-R TTGCTACTGCCTCTTCGTGTG
  Intergene_spec-F GGCCAAAATGCTAAATGGTCCT
  Intergene_spec-R CCTCACTTACCTCCCTTCCACA
  Affy_DLG2-F GCTCTATCCCATTGCCATCTT
  Affy_DLG2-R CGTTGTCAGAGGCGCAGTAT
  Affy_FLJ37266-F TGCCAGATCGTGTAACTGGTG
  Affy_FLJ37266-R TAGCCAAGAAATCCCGCAAA
RT-PCR controls GAPDH-F GGAAGGTGAAGGTCGGAGTCAAC
  GAPDH-R CCACTTGATTTTGGAGGGATCTCG
  β-actin-F ATGGATGATGATATCGCCGCGC
  β-actin-R TGATGGTGGGCATGGGTCAGAA
Sequencing Amp_F CGTCTCTAACAGAGGAACAAGCCAAG
  Amp_R GGAGTGTAAGCTGTGCAGTGTCTC
  DLG2_3'-F_2_ IRD800 GAAGCCATGAAGGAAACAGAGG
  DLG2_3'-F_IRD700 TTGATTGCCTATTTTGCCATTT
  DLG2_5'-F_ IRD700 ACCAGCTTTCGCTATGCAAC
  FLJ37266-F_IRD800 TGTTGATGTCTCTATGGCTCCA
  FLJ37266-R_IRD700 TGGAGCCATAGAGACATCAACA
LD-PCR FLJ37266_universal-R CAATTCTGTGGGAGGAGAGCAA
  DLG_exon22-F GGTGACGACGGTTATGGAACAA
  DLG_exon21-F ACAAGGAGCAGAGTGAGCAGGA
  DLG_exon20-F GTGCCCGATTGAAGACAGTGAA
  DLG_exon19-F ACGACAAGAGCAAGGACAGTGG
  DLG_exon18-F CCATGACCTACGAGAGCAGATGA
  DLG_exon17-F GGCTGGACAGACAGTGACGATT
  DLG_exon16-F GTGTCCTTCATTCTGGCTGGTG
  DLG_exon15-F ACATAGCACCGCAACTCGTCAG