Skip to main content

Table 2 Primers and conditions used for RT-PCR

From: A phase I study of hydralazine to demethylate and reactivate the expression of tumor suppressor genes

Primer set Sense 5'-- 3' Antisense 5'--- 3' Size Annealing
p16 AGCCTTCGGCTGACTGGCTGG CTGCCCATCATCATGACCTGG 150 60°C
RARβ GACTGTATGGATGTTCTGTCAG ATTTGTCCTGGCAGACGAAGCA 146 50°C
MGMT GCTGCAGACCAVCTCTGTGGCACG GCCGCCTCTTCACCATCCCG 81 50°C
FHIT ATGTCGTTCAGATTTGGCCAAC TCATAGATGCTGTCATTCCTGT 340 53°C
DAPK AACCCATCATCCATGCCATC TCTCTCCTTCTCGGTTCTTGA 200 51°C
APC GAGACAGAATGGAGGTGCTGC GTAAGATGATTGGAATTATCTTCT 180 56°C
GSTp1 TCCGCTGCAAATACATCTCC TGTTTCCCGTTGCCATTGAT 320 50°C
ER GGAGACATGAGAGCTGCCAAC CCAGCAGCATGTCGAAGATC 480 55°C