Skip to main content

Table 1 The sequences of the primers used for RT-PCR

From: Mycophenolate mofetil modulates adhesion receptors of the beta1 integrin family on tumor cells: impact on tumor recurrence and malignancy

mRNA Sense primer sequence Antisense primer sequence bp
GAPDH atcttccaggagcgagatcc accactgacacgttggcagt 509
alpha1beta1 catgcgctcgttttggaa cggccacatctcgggaccaga 309
alpha2beta1 gcatctcagaagtctgttgcc cctgttgttaccttcagggag 335
alpha3beta1 tacgtgcgaggcaatgaccta tttgggggtgcaggatgaagct 306
alpha6beta1 tggaggtacagttgttggcg ctccgttaggttcagggagt 253