Skip to main content

Table 2 Oligonucleotide primer sequences

From: Mutation analysis of genes that control the G1/S cell cycle in melanoma: TP53, CDKN1A, CDKN2A, and CDKN2B

TP53, exons 2 to 11 (GeneBank Accession: X54156)
Exon Primer Sequence 5'→3' Fragment (bp)
  PU2 (sense) TCCTCTTGCAGCAGCCAGACTGC  
  PD3 (antisense) AACCCTTGTCCTTACCAGAACGTTG  
4 PU4 (sense) CACCCATCTACAGTCCCCCTTGC 307
  PD4 (antisense) CTCAGGGCAACTGACCGTGCAAG  
5 PU5 (sense) CTCTTCCTACAGTACTCCCCTGC 211
  PD5 (antisense) GCCCCAGCTGCTCACCATCGCTA  
6 PU6 (sense) GATTGCTCTTAGGTCTGGCCCCTC 182
  PD6 (antisense) GGCCACTGACAACCACCCTTAACC  
7 PU7 (sense) GTGTTATCTCCTAGGTTGGCTCTG 139
  PD7(antisense) CAAGTGGCTCCTGACCTGGAGTC  
8 PU8 (sense) ACCTGATTTCCTTACTGCCTCTTGC 200
  PD8 (antisense) GTCCTGCTTGCTTACCTCGCTTAC  
9 PU9 (sense) GCCTCTTTCCTAGCACTGCCCAAC 102
  PD9 (antisense) CCCAAGACTTAGTACCTGAAGGGTG  
10 PU10 (sense) TGTTGCTGCAGATCCGTGGGCGT 130
  PD10 (antisense) GAGGTCACTCACCTGGAGTGAGC  
11 PU11 (sense) TGTGATGTCATCTCTCCTCCCTGC 153
  PD11 (antisense) GGCTGTCAGTGGGGAACAAGAAGT  
CDKN1A, exon 2 (GeneBank Accession: AF497972)
  p21-L1 (sense) GATGTCCGTCAGAACCCATG 258
  p21-R1 (antisense) TGCCTCCTCCCAACTCAT  
  p21-L2 (sense) ATGAGTTGGGAGGAGGCA 181
  p21-R2 (antisense) ATGCTGGTCTGCCGCCGTT  
CDKN2A, exons 1(GeneBank Accession: U12818) and 2 (GeneBank Accession: U12819)
1 MTS1-L1 (sense) GAAGAAAGAGGAGGGGCTG 340
  MTS1R1 (antisense) GCGCTACCTGATTCCAATTC  
2 p16-L2 (sense) GTCATGATGATGGGCAGC 307
  p16-R2 (antisense) CTGAGGGACCTTCCGCG  
CDKN2B, exon 2 (GeneBank Accession: AF513858)
  MTS2-L2 (sense) TAAGTTTAACCTGAAGGTGG 500
  MTS2-R (antisense) GGGTGGGAAATTGGGTAAG