Skip to main content

Table 1 The primers for RT-PCR analysis

From: Methylation profiles of thirty four promoter-CpG islands and concordant methylation behaviours of sixteen genes that may contribute to carcinogenesis of astrocytoma

Primer Name sequence PCR Product Length (bp) Accession Number
beta-actin L AAGTACTCCGTGTGGATCGG 616 NM_001101
beta-actin R TCAAGTTGGGGGACAAAAAG   
cdh13f GCTGGACTGGATGTTGGATT 246 NM_001257
cdh13t TTGAGGGTTGGTGTGGATTT   
magea1rf ACCTGACCCAGGCTCTGT 401 NM_004988
magea1rt CTCACTGGGTTGCCTCTG   
mgmtrf AAACGCACCACACTGGAC 404 NM_002412
imgmtrt AGGATGGGGACAGGATTG   
p73f AGATGAGCAGCAGCCACAG 218 NM_005427
p73t GTACTGCTCGGGGATCTTCA   
rassf1arf GTCTGCCTGGACTGTTGC 401 NM_007182
rassf1art AGCAGGGCCTCAATGACT