Skip to main content

Table 2 Primer sequences used for denaturing high performance liquid chromatography (DHPLC) and sequencing

From: No evidence for involvement of SDHD in neuroblastoma pathogenesis

amplicon forward reverse
SDHD exon 1 5'GCACCGCCTCTCGACTTC3' 5'TGCTGTGATTTCGGTATTTTCTTC3'
SDHD exon 2 5'AACCCCAGTGAAATAGATGCTATCTTC3' 5'AGTCCTGCTAAAGGCATGACCATTA3'
SDHD exon 3 5'CACTGCCTGTCAGTTTGGGTTAC3' 5'GGGCATTTCAATCAACTTCTCCC3'
SDHD exon 4 5'TCCCCTAAAGAAGCAAACAGTGAC3' 5'GAGCTTAATGGCATGACAAAGCAG3'
SDHD exon 4 Noncoding region (only for sequencing) 5'GTGGTTTTTTATTGATGTTATGATTTT3' 5'AATCTCAATTTACAGTTGGTAGTATTTT3'