Skip to main content

Table 1 Primer sequences used for homozygous exon deletion screening with real-time quantitative PCR

From: No evidence for involvement of SDHD in neuroblastoma pathogenesis

amplicon forward reverse
SDHD exon 1 5'AGGAACGAGATGGCGGTTCT3' 5'TCCTAGGGCACCGCAAAC3'
SDHD exon 2 5'CCAGTGGTCAGACCTGCTCAT3' 5'TGCTGCACTCCACACCATTC3'
SDHD exon 3 5'GACTAGCGAGAGGGTTGTCAGTGT3' 5'CATCGCAGAGCAAGGATTCA3'
SDHD exon 4 5'TGGCACTTTCAGCTTTAACCTTT3' 5'CACAGCATGGCAACAGCTTT3'