Skip to main content

Table 1 RT-PCR primer pairs used for mesothelin transcript amplification

From: Characterization of human mesothelin transcripts in ovarian and pancreatic cancer

amplification target sequence, 5' – 3' location expected product size
full length
(tr1 & 2)
ACCCACGGTGCCTCCCTCCC
TCAGGCCAGGGTGGAGGCTAG
exon 1
exon 17
1906 bp (tr1)
1924 bp (tr 2)
24 bp insert
region (tr1 & 2)
CTACCTCTTCCTCAAGATGAG
GTGTCTAGGGTGTCTTTGTCT
exon 12
exon 13
177 bp (tr1)
201 bp (tr2)
82 bp insert
region (tr1 & 3)
ATGAAGCTGCGGACGGATGCG
TGAGAACAGGTCCAGGTCCTA
exon 15
exon 17
262 bp (tr 1)
344 bp (tr 3)
tr3-specific ACCCACGGTGCCTCCCTCCC
ACCTCCACGCCCCCAGCTCTG
exon 1
intron 16
1873 bp