Skip to main content

Table 1 Primer sequences for DD and RT-PCR analysis.

From: Core I gene is overexpressed in Hürthle and non-Hürthle cell microfollicular adenomas and follicular carcinomas of the thyroid

Name Length Sequence (5' to 3')
DD
   T13A 14-mer TTTTTTTTTTTTTA
   T13G 14-mer TTTTTTTTTTTTTG
   T13C 14-mer TTTTTTTTTTTTTC
   D390 10-mer GTTGCGATCC
   D433 10-mer CTTGATTGCG
   D492 10-mer CAGTGTAGTC
   D495 10-mer TCGATACAGG
RT-PCR
   Core I R 19-mer GCAGAACTGTAGTCTGGAA
   Core I F 19-mer GGAGTAGTGCCATCTAGAT
   Actin R 20-mer ATGCTATCACCTCCCCTGTG
   Actin F 21-mer AAATCGTGCGTGACATTAAGG