Skip to main content

Table 2 Primer sequences used in RT-PCR validation

From: Expression profiling of blood samples from an SU5416 Phase III metastatic colorectal cancer clinical trial: a novel strategy for biomarker identification

Transcript Forward Primer Reverse Primer
Thrombospondin 1 TTGGCTACCAGTCCAGCAGC GGGTTGGTGTCCCAGTAGGA
MMP-9 CCCGGAGTGAGTTGAACCA CCTAGTCCTCAGGGCACTGC
Defensin α3 CCCAGAAGTGGTTGTTTCCCT GTCCATGTTTTTCCTTGAGCCT
Lactoferrin CTGGAAGCCTGTGAATTCC GAATGGCTGAGGCTTTCTTGG
Lipocalin-2 GCTGACTTCGGAACTAAAGGAGAA TGGGACAGGGAAGACGATGT
CD 24 CTGCCTCGACACACATAAACCTT CATCTAAGCATCAGTGTGTGACCA