Skip to main content

Table 1 Primers and PCR conditions

From: Human papilloma viruses and cervical tumours: mapping of integration sites and analysis of adjacent cellular sequences

Marker Primers 3'-5' Annealing T°C / time, sec Amplification product, bp
INT254 F: CTTTCAGCAAAGGATGTCATTG
R: GCAAGGCTTATTAAGCTTCAGC
57°C / 50 203
INT259 F: ATCTACAGACAGCATGGTACGG
R: TCAGAACACAACAAAAGGATGC
60°C / 45 107
INT431 F: TCCAAAAAAATGAGGCAATCTC
R: GGACTGAGGGAATAAACGACAC
60°C / 50 101
INT407 F: AGCAGGAGATGACAAGATGTTG
R: CACAAGTAGCTGAGACCACAGG
55°C / 35 103
INT290 F: AAGTTCCACCATTCAAGACCAG
R: TCATGATATCCTTGGTGTCCTG
55,5°C / 45 215