Skip to main content

Table 1 Oligonucleotides’ sequences and experimental conditions used for RT-PCR and EMSA analysis.

From: Specific nutrient combination effects on tax, NF-κB and MMP-9 in human T-cell lymphotropic virus -1 positive malignant T-lymphocytes

Experiment molecule Size (bp) Sequence # of Cycles Hybridization Temp (°C)
RT-PCR MMP-9 409 sense: 5’ CGCAGACATCGTCATCCAGT 3’
antisense: 5’ GGATTGGCCTTGGAAGATGA 3’
30 62
  Ribosomal phosphoprotein 486 sense: 5’ GTTCACCAAGGAGGACCTCA 3’
antisense: 5’ CACATTAGGCAGAGGTGTCT 3’
25 50
EMSA NF-κB probe 22 sense: AGTTGAGGGGACTTTCCCAGGC
antisense: GCCTGGGAAAGTCCCCTCAACT
- 37
  Mutant probe 22 sense: AGTTGAGGCGACTTTCCCAGGC
antisense: GCCTGGGAAAGTCGCCTCAACT
- 37