Skip to main content

Table 1 Sequences of RT-PCR oligonucleotide primers

From: Overexpression of SIRT1 promotes metastasis through epithelial-mesenchymal transition in hepatocellular carcinoma

  Sequence (5’ → 3’)
E-cadherin F TGAAGGTGACAGAGCCTCTGGA
R TGGGTGAATTCGGGCTTGTT
Vimentin F TGGCCGACGCCATCAACACC
R CACCTCGACGCGGGCTTTGT
Twist F GCCAGGTACATCGACTTCCTCT
R TCCATCCTCCAGACCGAGAAGG
SIRT1 F TGCTGGCCTAATAGAGTGGCA
R CTCAGCGCCATGGAAAATGT
Snail F CCTCCCTGTCAGATGAGGAC
R CCAGGCTGAGGTATTCCTTG
GAPDH F TGCCAAATATGATGACATCAAGAA
R GGAGTGGGTGTCGCTGTTG