Skip to main content

Table 1 Primers for site-directed mutagenesis of human TOP2B

From: Dexrazoxane may prevent doxorubicin-induced DNA damage via depleting both Topoisomerase II isoforms

T65I forward cattcttcttcgtcctgatatatatattgggtcagtggagc
  reverse gctccactgacccaatatatatatcaggacgaagaagaatg
Y66F forward tcttcgtcctgatacatttattgggtcagtggagc
  reverse gctccactgacccaataaatgtatcaggacgaaga
R178Q forward gatgagaaaaaagttacaggtggtcaaaatggttatggtgcaaaactttgta
  reverse tacaaagttttgcaccataaccattttgaccacctgtaacttttttctcatc
Y181S forward aaagttacaggtggtcgtaatggttctggtgcaaaactttg
  reverse caaagttttgcaccagaaccattacgaccacctgtaacttt
L185F forward ggtcgtaatggttatggtgcaaaattttgtaatattttcagtacaaagt
  reverse actttgtactgaaaatattacaaaattttgcaccataaccattacgacc
  1. The mutated sites are highlighted by italic bold letters.