Skip to main content

Table 3 The primers used in PCR amplification and sequencing

From: BRAF V600E mutation and KRAS codon 13 mutations predict poor survival in Chinese colorectal cancer patients

Genes Primers (sequence 5’-- > 3’)
KRAS  
Exon 2 F: TTAACCTTATGTGTGACATGTTCTAA
  R: ATCAAAGAATGGTCCTGCAC
BRAF  
Exon 15 F: CTTTACTTACTACACCTCAG
  R: TAACTCAGCAGCATCTCAGG
PIK3CA  
Exon 9 F: AGTAACAGACTAGCTAGAGACAAT
  R: CATGCTGAGATCAGCCAAAT
Exon 20 F: ATGATGCTTGGCTCTGGAAT
  R: TGTGGAATCCAGAGTGAGCTT