Skip to main content

Table 1 Primer sequences used for RT-PCR and Q-PCR in this study

From: Implication of metastasis suppressor gene, Kiss-1 and its receptor Kiss-1R in colorectal cancer

Genes Sense (5'-'3) Antisense (5'-'3)
Kiss-1 Conventional PCR TGAACTCACTGGTTTCTTGG CGAAGGAGTTCCAGTTGTAG
Quantitative PCR CATTAGAAAAGGTGGCCTCT ACTGAACCTGACCGTACAGCCCAGGGATTCTAGCTG
Anti-Kiss1 ribozyme1 CTGCAGCTCTCGGGGGGCGGGGACAGCGAGGTCCCCCCTGATGAGTCCGTGAGGA ACTAGTGCCAGCTGCTACTGCCAGGCTGAGCCGTTTCGTCCTCACGGACT
Anti-Kiss-1 ribozyme2 CTGCAGCACCGCGCCCTGGGGTGCGGGCTGATGAGTCCGTGAGGA ACTAGTGTCCGCCCCCCACAGCCGCCAGATTTCGTCCTCACGGACT
Kiss-1R Conventional PCR CTTCATGTGCAAGTTCGTC CACCAGGAACAGCTGGAT
Quantitative PCR GCTGGTCATCTACGTCATCT ACTGAACCTGACCGTACACAGCACAGGAGGAAGGTC
Anti-Kiss-1R ribozyme1 CTGCAGTTCCGCATCGGCTTGTGGCGGCACTGATGAGTCCGTGAGGA ACTAGTTCGCTGGTCATCTACGTCATTTCGTCCTCACGGACT
Anti-Kiss-1R ribozyme2 CTGCAGAGCCTACCCAGATGCTGAGGCTCTGATGAGTCCGTGAGGA ACTAGTGCCCCGCCTGGCGCTGGCTGTTTCGTCCTCACGGACT
GAPDH Conventional PCR GGCTGCTTTTAACTCTGGTA GACTGTGGTCATGAGTCCTT
  Quantitative PCR CTGAGTACGTCGTGGAGTC ACTGAACCTGACCGTACACAGAGATGATGACCCTTTTG