Skip to main content

Table 1 Information on primers used in RT-PCRs

From: Intratumoral heterogeneity impacts the response to anti-neu antibody therapy

Genes NCBI No. Forward (5′-3′) Reverse (5′-3′) Size(bp)
MMP1a NM_032006 AGACTTCTCTGGTTGCCG AGAGCCTCCAATCACTGTGC 210
MMP2 NM_008610 CTATTCTGTCAGCACTTTGG CAGACTTTGGTTCTCCAACTT 309
MMP3 NM_010809 TGTACCAGTCTACAAGTCCTCCA CTGCGAAGATCCACTGAAGAAGTAG 659
MMP7 NM_010810 CTGCCACTGTCCCAGGAAG GGGAGAGTTTTCCAGTCATGG 175
MMP8 NM_008611 TGACTCTGGTGATTTCTTGCTAA GTGAAGGTCAGGGGCGATGC 164
MMP9 NM_013599 CTCAGAGATTCTCCGTGTCCTGTA GACTGCCAGGAAGACCTTGGTTA 241
MMP10 NM_019471 AGTTGCTCCTGCATGTTCTG TGCATCCTCTCACCTACTGC 120
MMP11 NM_008606 CCGGAGAGTCACCGTCATC GCAGGACTAG GGACCCAATG 110
MMP14 NM_008608.3 CTGATGACGATCGCCGTGGCATCC GCGTCTGAAGAAGAAGACAGCGAGG 878
CDH1 NM_009864 CCATTTTCACGCGCGCTG CGCGAGCTTGAGATGGAT 396
CDH2 NM_007664 AGCGCAGTCTTACCGAAGG TCGCTGCTTTCATACTGAACTTT 110
Krt18 NM_010664 CAGCCAGCGTCTATGCAGG CCTTCTCGGTCTGGATTCCAC 123
Claudin1 NM_016674 GGGGACAACATCGTGACCG AGGAGTCGAAGACTTTGCACT 100
Occludin NM_008756 TTGAAAGTCCACCTCCTTACAGA CCGGATAAAAAGAGTACGCTGG 129
Ctnna1 NM_009818 AAGTCTGGAGATTAGGACTCTGG ACGGCCTCTCTTTTTATTAGACG 115
Ctnnb1 NM_007614 ATGGAGCCGGACAGAAAAGC CTTGCCACTCAGGGAAGGA 108
Jup NM_010593 TGGCAACAGACATACACCTACG GGTGGTAGTCTTCTTGAGTGTG 135
DDR2 NM_022563 ATCACAGCCTCAAGTCAGTGG TTCAGGTCATCGGGTTGCAC 116
Fibronectin NM_010233 AGAGCAAGCCTGAGCCTGAAG TCGCCAATCTTGTAGGACTGACC 192
FOXC2 NM_013519 AACCCAACAGCAAACTTTCCC GCGTAGCTCGATAGGGCAG 130
S100a4 NM_011311 TGAGCAACTTGGACAGCAACA TTCCGGGGCTCCTTATCTGGG 124
SNAI1 NM_011427 CACACGCTGCCTTGTGTCT GGTCAGCAAAAGCACGGTT 133
SNAI2 NM_011415 TGGTCAAGAAACATTTCAACGCC GGTGAGGATCTCTGGTTTTGGTA 131
Acta2 NM_007392 GTCCCAGACATCAGGGAGTAA TCGGATACTTCAGCGTCAGGA 102
Twist1 NM_011658 GGACAAGCTGAGCAAGATTCA CGGAGAAGGCGTAGCTGAG 146
Vimentin NM_011701 CGGCTGCGAGAGAAATTGC CCACTTTCCGTTCAAGGTCAAG 124
GAPDH NM_008084 TTCACCACCATGGAGAAGGC GGCATGGACTGTGGTCATGA 250