Skip to main content

Table 1 Primers for qPCR analysis

From: The impact of S6K1 kinase on neuroblastoma cell proliferation is independent of GLI1 signaling

Primer name Sequence
S6K1 5′ ACATGCTGACTGGAGCACCCCCAT
5′ GGCTTCTTGTGTGAGGTAGGGAGGCA
GLI1 5′ AGCTACATCAACTCCGGCCAATAGGG
5′ TGCTGCGGCGTTCAAGAGAGACTG
GLI2 5′ GACATGCGACACCAGGAAGGAAGGT
5′ GCCGGATCAAGGAGATGTCAGAGATG
GLI3 5′ TGGACCCCAGGAATGGTTACATGGAG
5′ TGCAATGGAGGAATCGGAGATGGAT
SMO 5′ TTTCTGTCACCCCTGTGGCAACTCC
5′ CGGGCACACCTCCTTCTTCCTCTTC
PTCH2 5′ TCTTTCTGGGACTGTTGGCCTTTGG
5′ CCTCCCCCAGCTTCTCCTTGGTGTA
TBP 5′ GCCAGCTTCGGAGAGTTCTGGGATT
5′ CGGGCACGAAGTGCAATGGTCTTTA