Skip to main content

Advertisement

Table 1 Test and control c-Myc shRNA sequence

From: Combination of hepatocyte specific delivery and transformation dependent expression of shRNA inducing transcriptional gene silencing of c-Myc promoter in hepatocellular carcinoma cells

Name Sequence 5′ to 3′
c-myc shRNA test sense strand GATCCGAACGGAGGGAGGGATCGCGCTTTTTCAAGAGAAGCGCGATCCCTCCCTCCGTTCTTA
c-myc shRNA test antisense strand AGCTTAAGAACGGAGGGAGGGATCGCGCTTCTCTTGAAAAAGCGCGATCCCTCCCTCCGTTCG
c-myc shRNA scrambled sense strand GATCCAGCGGTCGAGACGTGGCGGAGATTTTCAAGAGATCTCCGCCACGTCTCGACCGCTTTA
c-myc shRNA scrambled antisense strand AGCTTAAGCGGTCGAGACGTGGCGGAGATCTCTTGAAAATCTCCGCCACGTCTCGACCGCTG