Skip to main content

Table 2 qPCR primers

From: Expression of miR-34c induces G2/M cell cycle arrest in breast cancer cells

Primers for qPCR Sequence 5’ to 3a
SDHA forward TGGGAACAAGAGGGCATCTG
SDHA reverse CCACCACTGCATCAAATTCATG
YWHAZ forward ACTTTTGGTACATTGTGGCTTCAA
YWHAZ reverse CCGCCAGGACAAACCAGTAT
UBC forward ATTTGGGTCGCGGTTCTTG
UBC reverse TGCCTTGACATTCTCGATGGT
PRKCA forward AAACATCTCCACCCAAGACG
PRKCA reverse AATCCCTCCCTGCTCACTCT
CCND1 forward CCCTCGGTGTCCTACTTCAA
CCND1 reverse CTCCTCGCACTTCTGTTCCT
CDCK4 forward TGTGGAGTGTTGGCTGTATCTT
CDCK4 reverse GGTCGGCTTCAGAGTTTCC
CDCK6 forward TGGTGCCTCCTCTTGTCTG
CDCK6 reverse CTGCCTGTTCCCACTACTCC
CDC23 forward CGGAGTTGGCTTTCTCTCTC
CDC23 reverse CCTGGGCATCTTCCTCTGTA