Skip to main content

Table 1 EMSA probes

From: The transcriptional responsiveness of LKB1 to STAT-mediated signaling is differentially modulated by prolactin in human breast cancer cells

Probe Sequence (5’-3’) Length
GAS AGCATTATCTCCAGATACCAAGGGGTTGGGGTGTGAGCCA 40 bp
GASmut AGCATTATCTCCAGATTAGTTTAAGTTGGGGTGTGAGCCA 40 bp
Oct1 (non-specific) AGAGGATCCATGCAAATGGACGTACG 26 bp