Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 Sequences of primers used in this study

From: COUP-TFI modifies CXCL12 and CXCR4 expression by activating EGF signaling and stimulates breast cancer cell migration

Gene name and symbol Forward primer Reverse primer
Chemokine (C-X-C motif) receptor 4 (CXCR4) GCCTTATCCTGCCTGGTATTGTC GCGAAGAAAGCCAGGATGAGGAT
Chemokine (C-X-C motif) receptor 7 (CXCR7) ACAGGCTATGACACGCACTG ACGAGACTGACCACCCAGAC
Chemokine (C-X-C motif) ligand 12 (CXCL12) CACCATTGAGAGGTCGGAAG AATGAGACCCGTCTTTGCAG
Nuclear receptor subfamily 2, group F, member 1 (NR2F1) (COUP-TFI) TACGTGAGGAGCCAGTACCC CGATGGGGGTTTTACCTACC
Epidermal Growth Factor (EGF) CAGGTAATGGAGCGAAGCTTTCA GTGCATCGACATAGTTCATTCTTCTTG
Epidermal Growth Factor receptor (EGFR) GGAGAACTGCCAGAAACTGACC GCCTGCAGCACACTGGTTG
GlycerAldehyde-3-Phosphate DesHydrogenase (GAPDH) GGGCATCCTGGGCTACACTG GAGGTCCACCACCCTGTTGC
18S RNA GCAATTATTCCCCATGAACG AGGGCCTCACTAAACCATCC