Skip to main content

Table 1 Sequences of primers used in this study

From: COUP-TFI modifies CXCL12 and CXCR4 expression by activating EGF signaling and stimulates breast cancer cell migration

Gene name and symbol Forward primer Reverse primer
Nuclear receptor subfamily 2, group F, member 1 (NR2F1) (COUP-TFI) TACGTGAGGAGCCAGTACCC CGATGGGGGTTTTACCTACC