Skip to main content

Table 1 Primer sequences for semi-quantitative RT-PCR

From: Suberoylanilide hydroxamic acid, an inhibitor of histone deacetylase, suppresses vasculogenic mimicry and proliferation of highly aggressive pancreatic cancer PaTu8988 cells

Gene name (mRNA ID) Primer name Primers sequences (5’-3’) PCR product size (bp)
β-actin Forw AAGAGCTACGAGCTGCCTGACG 420
(NM_001101.3) Rev CGCCTAGAAGCATTTGCGGTGG
Cyclin D1 Forw CATCTCTGTACTTTGCTTGCTCAT 499
(NM_053056.2) Rev CGCTATTTCCTACACCTATTGGAC
Cyclin B1 Forw TCAACATGGCAGGCGCAAAGC 224
(NM_031966.3) Rev TGGCACTGGCACCAGCATAGGT
CDK1 Forw TGCTGGGGTCAGCTCGTTACTCA 232
(NM_001786.4) Rev TGGGATGCTAGGCTTCCTGGTT
p53 Forw GGGAGTAGGACATACCAGCTTAGAT 452
(NM_000546.4) Rev TTAGGTACTAAGGTTCACCAAGAGG
p21 Forw CTGCCTTAGTCTCAGTTTGTGTGT 412
(NM_000389.3) Rev CAAAGTGCCATCTGTTTACTTCTC
CDK4 Forw CTTGATCTGAGAATGGCTACCTCT 409
(NM_000075.2) Rev CATGAAGGAAATCTAGGCCTCTTA
MAGEF1 Forw GGGTATCCGAAGAGGCTTATTATGG 749
(NM_022149.4) Rev AAGCAAATGAAGGTACATGCCAGTC
FGFR1 Forw GAGGAGAAAGAAACAGATAACACCA 427
(NM_023108.2) Rev TGTACACCTTACACATGAACTCCAC
HIF1A Forw GTAAGAAGGCAGTAACCTTTCATCA 502
(NM_001530.3) Rev AGGGTAGGCAGAACATTTAGGTTTA
RUNX1 Forw AGATTTAATGACCTCAGGTTTGTCG 328
(NM_001754.4) Rev GACTCTGAGGCTGAGGGTTAAAG
Sema4D Forw TGTCTGTGGAGTATGAGTTTGTGTT 552
(NM_006378.3) Rev GGGTGTAGTTCACATCTTTCTTGAT
VEGFA Forw AGAAGAGACACATTGTTGGAAGAAG 439
(NM_003376.4) Rev CGGTACAAATAAGAGAGCAAGAGAG
MAGED1 Forw TCGGTCTCCTCTTGGTGATTCTGG 200
(NM_006986.3) Rev GTTGCTGTTGGGCACTCGTCTGT
Intergrin β5 Forw TGCCATGCAGGTTACATCGG 353
(NM_002213) Rev ATCATGACGCAGTCCTTGGC
WIPF2 Forw CTCCTTTACTCAGACATAGAGCATCA 484
(NM_133264.4) Rev AGACCACCCAATCTTCCACGAA
ZFP106 Forw CCCACCTCTCACCCCTATTTCCTA 280
(NM_022473.1) Rev AACACCTCACCTACCCGTTTCCTG  
  1. Note: Forw: the forward primer; Rev: the reverse primer; CDK1: cyclin-dependent kinase 1; CDK4: cyclin-dependent kinase 4; FGFR1: fibroblast growth factor receptor 1; HIF1A: hypoxia inducible factor 1, alpha subunit; MAGED1: melanoma antigen family D1; FGFR1:fibroblast growth factor receptor 1; VEGFA: vascular endothelial growth factor A; Sema4D:Sema domain, immunoglobulin domain (Ig), transmembrane domain and short cytoplasmic domain, 4D; WIPF2: WAS/WASL interacting protein family, member 2; MAGEF1: melanoma antigen family F1; MAGED1: melanoma antigen family D1; ZFP106: zinc finger protein 106 homolog; RUNX1: runt-related transcription factor 1.