Skip to main content

Advertisement

Table 2 Primer sequences used for methylation analysis

From: Epigenetic modulation of the drug resistance genes MGMT, ABCB1 and ABCG2 in glioblastoma multiforme

Gene symbol GenBank accession Forward primer 5′- > 3′ Reverse primer 5′- > 3′ Sequencing primer 5′- > 3′ Amplicon size (bp)
MGMT X61657.1 YGYGTTTYGGATATGTTGGGATAG Biotin -AACRAAA CRACCCAAACACTCA GGATAGTTYGYGTTTTTAGA 115
ABCB1 AH002875.1 GTGGGTGGGAGGAAGTAT Biotin -AAATCTC CAACATCTCCAC GGGTAAAGTTTAGAA 125
ABCG2 AH011213.2 TGATTGGGTAATTTGTGTGTTAGTG Biotin -AAATAAA CCAAAATAATTA ACTAC TTGTGATTGGGTAATTTGTG 147