Skip to main content

Table 6 QPCR primers

From: Molecular profiling of cutaneous squamous cell carcinomas and actinic keratoses from organ transplant recipients

Gene Accession number Forward primer 5 > 3 Reverse primer 5 > 3 Amplicon size (bp)
Genes of interest
CCL27 NM_006664 GACTGTCACCTCCAGGCTTT TCTCTTGGTGCTCAAACCAC 100
K17 NM_000422 CTGGAGCAGGAGATTGCCAC GGGTGGTCACCGGTTCTTTC 88
MMP1 NM_002421 AGGTCTCTGAGGGTCAAGCA CTGGTTGAAAAGCATGAGCA 111
MMP3 NM_002422 TGCTTTGTCCTTTGATGCTG GGAAGAGATGGCCAAAATGA 135
MMP9 NM_004994 CCTGGAGACCTGAGAACCAA ATTTCGACTCTCCACGCATC 103
MMP10 NM_002425 GTGGAGTTCCTGACGTTGGT TCAATGGCAGAATCAACAGC 130
PI3 NM_002638 GACTGCCCAGGAATCAAGAA CAGCAGGGACTTAGGACCAG 148
SERPINB4 NM_002974 CAAAGGGCAGTGGGAGAATA CCTCCAGCAAGGCAAAATTA 131
TUBB3 NM_006086 CTCAGGGGCCTTTGGACATC CCCTCCGTGTAGTGACCCTT 96
Reference genes
ARPC2 NM_005731 TCCGGGACTACCTGCACTAC GGTTCAGCACCTTGAGGAAG 96
BAT3 NM_004639 AAGAGACGCAAGACGATGCAG TGTAGCTCTCCTGAACCTCTGG 151
RPS29 NM_001032 TATGTGCCGCCAGTGTTTCC TGCCCCGGATAATCCTCTGA 92
ZNF410 NM_021188 GCTGTGGTAAGCAGTTTACTACAG CTTGGGCTTCACAAAGGAAAGG 90