Skip to main content

Table 1 Oligonucleotides used for the qRT-PCR analysis

From: Restoration of WNT4 inhibits cell growth in leukemia-derived cell lines

  Gene name Sequence accession number Primer sequence Primer location (Exon) Prod. length T°a
WNT4 ORF Wingless-type MMTV integration site family, member 4 NM_030761 F GGCACCATGAGTCCCCGCTCG 99–119 (1) 1055 60
R GCAGGGCTAGGCAGGCGGTCA 1158–1178 (5)
WNT4 Wingless-type MMTV integration site family, member 4 NM_030761 F GGAACTGCTCCACACTCGACTC 364–385 (3) 259 60
R CGCACATCCACAAACGACTGT 602–622 (4)
MYC V-myc myelocytomatosis viral oncogene homolog (avian) NM_002467.4 F CCAGCGCCTTCTCTCCGTC 1208–1226 (2) 302 60
R GGGAGGCGCTGCGTAGTTGT 1490–1509 (3)
JUN Jun proto-oncogene NM_002228.3 F TGGAAAGTACTCCCCTAACCT 2786–2806 (1) 250 60
R CTGAAACATCGCACTATCCTT 3015–3035 (1)
FOSL1/FRA1 FOS-like antigen 1 NM_005438.3 F AGGAACCGGAGGAAGGAACTG 554–574 (3) 199 60
R TGCCACTGGTACTGCCTGTGT 732–752 (4)
AXIN2 Axin 2 NM_004655.3 F AAAAAGGGAAATTATAGGTATTAC 2678–2701 (10/11) 277 54
R CGATTCTTCCTTAGACTTTG 2935–2954 (11)
CCND1 cyclin D1 NM_053056.2 F CCCCAACAACTTCCTGTCCTAC 866–887 (4) 236 60
R GCCCTCAGATGTCCACGTC 1083–1101 (5)
SURVIVIN/BIRC5 Homo sapiens baculoviral IAP repeat containing 5 NM_001012271.1 F TGAGCTGCAGGTTCCTTATCTG 1057–1078 (5) 234 60
R GAATGGCTTTGTGCTTAGTTTT 1269–1290 (5)
RPL32 Ribosomal protein L32 NM_000994.3 F GACTTGACAACAGGGTTCGTAG 213–234 (3) 320 60
R ATTTAAACAGAAAACGTGCACA 511–532 (4)
RPS18 Ribosomal protein S18 NM_022551.2 F CGATGGGCGGCGGAAAA 105–121 (2) 283 58
R CAGTCGCTCCAGGTCTTCACGG 366–387 (5)
ACTB Beta Actin NM_001101.3 F TCCGCAAAGACCTGTACG 950–967 (5) 298 60
    R AAGAAAGGGTGTAACGCAACTA 1226–1247 (6)