Skip to main content

Table 1 Sequence and reaction conditions of nested MSP and real-time PCR primer

From: Axin gene methylation status correlates with radiosensitivity of lung cancer cells

Name Sequence Length TM Cycle
MSP primers     
Axin promoter (Outside primer) F:5′GGAGGTTTTGGTTTTTTAGAGAGYGGAG 3′ 298 bp 55°C 35
  R: 5′AAACCCTAACCATCCCTACCTACCRACC 3′    
Axin promoter methylation F: 5′GTAGGTTTTTGGAATGGTCGC 3′ 144 bp 55.7°C 35
  R: 5′ACTAAACAAAAAACCCCGAA 3′    
Axin promoter unmethylation F: 5′ GTAGGTTTTTGGAATGGTTGTGG 3′ 144 bp 55.2°C 35
  R: 5′ ACTAAACAAAAAACCCCAAA 3′    
Axin intron 1 (Outside primer) F: 5′TGTTTATAATTTTAGTTATTTGGGAAGGT 3′ 283 bp 55°C 35
  R: 5′ACCCCTTATTTTTACTCACACTTCTATT 3′   
Axin intron 1 methylation F:5′ GTTGAGGTAGGAGAATCG 3′ 222 bp 59.3°C 35
  R:5′ TCTTCAGGAAAAATCTCG 3′   
Axin intron 1 unmethylation F:5′ GTTGAGGTAGGAGAATAG 3′ 222 bp 59°C 35
  R:5′ TCTTCAGGAAAAATCTAG 3′   
Axin intron 2 (Outside primer) F: 5′ GGATAAATATAGAAAAGGGTTAGGAATG 3′ 362 bp 57.5 35
  R: 5′ ATAAACTAAAAAACTCCTCAAATACCAC 3′    
Axin intron 2 methylation F:5′ AAGTGAGAGTTTAGGTAGAGGAGGC3′ 238 bp 58°C 35
  R:5′ CAAAAAAACTAAATACCTATAACCG 3′    
Axin intron 2 unmethylation F:5′ GAGAGTTTAGGTAGAGGAGGT 3′ 234 bp 59.5°C 35
  R:5′ CAAAAAAACTAAATACCTATAACCA 3′   
Real-time PCR primers     
Axin primer F: 5′- TCACCCTGGGCCAGTTCAA -3′    
  R: 5′-CAGTCAAACTCGTCGCTCACTTTC -3′   
β-actin primer F:5′- AGCACAGAGCCTCGCCTTTG -3′    
  R:5′- ACATGCCGGAGCCGTTGT -3′