Skip to main content

Table 2 Primer sequences for PSQ

From: Diagnostic markers of urothelial cancer based on DNA methylation analysis

Gene Annotation Forward Reverse Sequencing Sequence analyzed Amplicon location relative to transcription start site
SOX1 Sex determining region Y box1 GGTATTTGGGATTAGTATATGTTTAG CTATCTCCTTCCTCCTAC TTAGTATATGTTTAG CGTACGCGGCGCGTCG -462~ -351
TJP2 Tight junction protein 2 GGTTTTTAGATAGGATTTAAAATTTTGAG CAAAACCTCACACAAACAACTTC AGGTTTTTTTAGTT CGATTTTTCG -492~ -409
MYOD1 Myogenic differentiation 1 GTGGGTATTTAGATTGTTAGTA ACAATAACTCCATATCCTAAC GAAGTTAGGAT CGTGTCGCGTTATCG +96~ +233
HOXA9_1 Homeo box A9 TTGTTTAATTTTATGTGAGGGGTTT CAAATCTAACCTTATCTCTATACTCTCCC TGATATAAAATAGTT CGTTTAAG -397~ -243
HOXA9_2 Homeo box A9 ATGAAATTTGTAGTTTTATAATTTT ATTACCCAAAACCCCAATAATAAC GTTTTATAATTTT CGTGGGTCGGGTCGGGCGG +10~ +100
GALR1 Galanin receptor 1 ATTAATGGA TGAGGAGGTT ATACCAAAAA CTTCTCTACT AC GTGATTTTTA AGGGG CGCGGATTTT AGTCGAGTTG -194~ +110
IPF1 Insulin promoter factor 1 GTAGTTTTAA GAGGAAGG AAAAATTAAA ACCCATTTAA CCAA GTAGTTTTAA GAGGAAGGT CGCGTTTTTTTTTTTCGTTG -786~ -702
TAL1 T-cell acute lymphocytic leukemia 1 GTAAATAGAA GGAGGTTTT ACACTACTTT CAAAAATATA AC AGAA GGAGGTTTT CGTAG TTAATTTAAG ATTTCG -613~ -470
EYA4 Eyes absent homolog 4 GGATGTTTTGTTTTTATTAGAGGTATAG AATTCTCTCAACTCAAACTCCC GAAGGGGAAATTT CGATATTGGAAGGAACG +252~ +457
CDH13 Cadherin 13 AGTTTAAAGAAGTAAATGGGATGTTA CTTCCCAAATAAATCAACAACAAC ATTTGTTATGTAAAA CGAGGGAGCGT -175~ +6
CYP1B Cytochrome P450 family 1 GTTTTGATTTTGGAGTGGGAGT CTACCCTTAAAAACCTAACAAAATC AGGGTATGGGAATTGA CGTTATTTATCGA +26~ +178
NPY Neuropeptide Y GGGTTGTTTT TATTTTTGGT AGGATTAGA CACCAAAACC CAAATATCTA CCC AGGAAAGTAGGGAT CGGGT ATTGTTCGAG -353~ -253
VAMP8 Vesicle-associated membrane protein 8 AAGTTTTTGT TTGGGAAGTT ATT CATATCTCAA AACAACCCAA GTTAGGTGTG GTTGGAG CGATTCGAGATGCGAGGTGG -157~ +56
CASP8 Caspase 8 GAAGTTTGATTTTGTTGGTTTAAAA CAACCTCTCTAACTAAACCCTCCTT TGTTTAGAGGTTG CGGGTTGCGGGT +431~ +533
SPP1 Secreted phosphoprotein 1 GGAATAAGGA TAGGTAGGT CAAAATAACT ACTTAAAAAA ACTACTTCAA GAATAAGGAT AGGTAGGTTG GG CGATTTGTTTAAGGTTGTAT +99~ +117
CAPG Capping protein GGGGTAGGTTGGAAGGAAGA ACAACCACCCTACCACCTTCA GTTGGAAGGAAGA CGAATTTACGAAGT +200~+294
RIPK3 Receptor-interacting serine-threonine kinase 3 GTTTTTGGAA GGTGAGGAT AAAACTAATA CCTTTCTCCT TAACT ATTTAATT TGGTTG CGGT AGGTGTTTAG GAAACG -137~ -27
IFNG Interferon gamma receptor 1 AATAGTATTTGTTTGTGGTTGAA TAACACCAAATCTCAAAATAACT GAAAATGATTGAATAT CGATTTG +257~ +359
HLADPA1 Major histocompatibility complex, class II, DP alpha 1 AATTTTGAAAATGAATTGTGAATTG CATTCTCTATTACTAAATAAAAAAAAC GAGTTTTTTTGATTA CGTTGGTA -74~ +38