Skip to main content

Advertisement

Table 1 Primer sequences used for PCR amplification

From: The association of N-palmitoylethanolamine with the FAAH inhibitor URB597 impairs melanoma growth through a supra-additive action

RPL19 F: gaaggtcaaagggaatgtgttca FAAH F: gagatgtatcgccagtccgt
  R: ccttgtctgccttcagcttgt   R: acaggcaggcctataccctt
MAGL F: atggtcctgatttcacctctggt NAAA F: ggttttatccctgtttcctgtttat
  R: tcaacctccgacttgttccgagaca   R: tttttgacaatacatcaccttcagct
CB1 F: ctgatgttctggatcggagtc CB2 F: tgacaaatgacacccagtcttct
  R: tctgaggtgtgaatgatgatgc   R: actgctcaggatcatgtactcctt
GPR55 F: atttggagcagaggcacgaacatga TRPV1 F: aactcttacaacagcctgtattccaca
  R: agtggcgatatagtccagcttcct   R: aagacagccttgaagtcatagttct
PPARα F: caacggcgtcgaagacaaa PPARγ F: ctgctcaagtatggtgtccatga
  R: tgacggtctccacggacat   R: tgagatgaggactccatctttattca