Skip to main content

Table 1 Synthetic oligonucleotides used in MSE and conventional bisulfite-DGGE

From: The application of methylation specific electrophoresis (MSE) to DNA methylation analysis of the 5' CpG island of mucin in cancer cells

Primer name sequence Tm
A. The nested PCR primer set
MUC1 Forward: 5'-AAAGGGGGAGGTTAGTTGGA-3' 63
  Reverse: 5'-TACCCCTCACCTATAAACAC-3'  
MUC2 Forward: 5'-TTTGGGGTTAGGTTTGGAAG-3' 59
  Reverse: 5'-ACCTTCTTCAAAATAAAACAACC-3'  
MUC3A Forward: 5'-TTGAGGGATAGAAGGGGTTTG-3' 64
  Reverse: 5'-AACCCCAACAACTACATAAACCC-3'  
MUC4 Forward: 5'-AGAGTAAGGGGTGTATGGGTG-3' 60
  Reverse: 5'-ACTCCACTACCCAACAACTAC-3'  
MUC5AC Forward: 5'-AAAGTTTTGGGTGTGTGGAG-3' 62
  Reverse: 5'-ATCAATATCCAACCCCCAAC-3'  
MUC17 Forward: 5'-ATAAAGGGGGTGTTTTTGTTAGG-3' 62
  Reverse: 5'-AAACAAACAAAACAAACTAACCCC-3'  
B. The target PCR primer set
MUC1 Forward: 5'-[GC CLAMP]AAGAGGTAGGAGGTAGGGGA-3' 53
  Reverse: 5'-AAAACAAAACAAATTCAAAC-3'  
MUC2 Forward: 5'-[GC CLAMP]TTTTAGAGTTTGGGTTTTAG-3' 51
  Reverse: 5'-TAACCTAAATACCAACACAC-3'  
MUC3A Forward: 5'-[GC CLAMP]TTTTAGGTAGTTTTATGTGG-3' 52
  Reverse: 5'-AACAAAAAACTAAAACAAAAC-3'  
MUC4 Forward: 5'-[GC CLAMP] AGGAGAGAAAAGGGTGATTAG -3' 57
  Reverse: 5'-ACTCCACTACCCAACAACTAC-3'  
MUC5AC Forward: 5'-[GC CLAMP]TTTATGTTTAGGGGTTTTGG-3' 62
  Reverse: 5'-ACCAACTAACCACCCAAACC-3'  
MUC17 Forward: 5'-[GC CLAMP]ATTTTTATGTTTATGGGTTG-3' 53
  Reverse: 5'-ATAATCCCTAACCTTAACATC-3'  
  1. *[GC CLAMP]:5'-CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCACGGGGGG-3'