Skip to main content

Table 1 qRT-PCR primer sequences and amplicon sizes

From: Anti-apoptotic gene transcription signature of salivary gland neoplasms

cDNA Forward primer Reverse primer Product length
BAX 5'GAGCTGCAGAGGATG ATT GC 3' 5'CAGCTGCCACTCGGAAAA3' 70 bp
BCL-2 5'AGGCTGGGATGCCTTTGT3' 5'CAGCCAGGAGAAATCAAACAG3' 67 bp
CASP3 5'TCATAAAAGCACTGGAATGACATC3' 5'TTCTGAATGTTTCCCTGAGGTT3' 74 bp
ACTB 5'TGCCGACAGGATGCAGAAG3' 5'CTCAGGAGGAGCAATGATCTTGA3' 77 bp