Skip to main content

Table 2 Information of the oligonucleotides used for the qRT-PCR analysis

From: Peripheral T-lymphocytes express WNT7A and its restoration in leukemia-derived lymphoblasts inhibits cell proliferation

  Gene Name Sequence Accession Number Primer Sequence Primer Location (Exon Prod. Length T°a
WNT7A Wingless-type MMTV integration site family, member 7A NM_004625 F CAAAGAGAAGCAAGGCCAGTA
R GTAGCCCAGCTCCCGAAACTG
707-730 (3)
962-983 (4)
277 60
MYC V-myc myelocytomatosis viral oncogene homolog (avian) NM_002467.4 F CCAGCGCCTTCTCTCCGTC
R GGGAGGCGCTGCGTAGTTGT
1208-1226 (2)
1490-1509 (3)
302 60
JUN Jun proto-oncogene NM_002228.3 F TGGAAAGTACTCCCCTAACCT
R CTGAAACATCGCACTATCCTT
2786-2806 (1)
3015-3035 (1)
250 60
FRA-1 FOS-like antigen 1 NM_005438.3 F AGGAACCGGAGGAAGGAACTG
R TGCCACTGGTACTGCCTGTGT
554-574 (3)
732-752 (4)
199 60
AXIN2 Axin 2 NM_004655.3 F AAAAAGGGAAATTATAGGTATTAC
R CGATTCTTCCTTAGACTTTG
2678-2701 (10/11)
2935-2954 (11)
277 54
GAPDH Glyceraldehyde-3-phosphate dehydrogenase NM_002046.3 F CACTGCCACCCAGAAGACTGTG
R TGTAGGCCATGAGGTCCACCAC
645-666 (8)
1072-1089 (9)
449 63
RPL32 Ribosomal protein L32 NM_000994.3 F GACTTGACAACAGGGTTCGTAG
R ATTTAAACAGAAAACGTGCACA
213-234 (3)
511-532 (4)
320 60
RPS18 Ribosomal protein S18 NM_022551.2 F CGATGGGCGGCGGAAAA
R CAGTCGCTCCAGGTCTTCACGG
105-121 (2)
366-387 (5)
283 58
B2M Beta-2-microglobulin NM_004048.2 F GAGGCTATCCAGCGTACTCCAA
R CACACGGCAGGCATACTCAT
115-136 (1/2)
347-366 (2)
252 58
ACTB Actin beta NM_001101.3 F TCCGCAAAGACCTGTACG
R AAGAAAGGGTGTAACGCAACTA
950-967 (5)
1226-1247 (6)
298 60