Skip to main content

Advertisement

Table 1 Primer sequences and PCR settings

From: LFA-1 and ICAM-1 expression induced during melanoma-endothelial cell co-culture favors the transendothelial migration of melanoma cell lines in vitro

Gene name Primer direction Sequences (5’-3’) Number of cycle Hybridization temperature
CD11a Forward GGGAATGACCTTGGCAACAGACCCCACAGAT 34 58
  Reverse GGGTCTCCTGACTCTCCTTGGTCT   
CD18 Forward CATCAGAGCTGCTGTAGAGC 31 60
  Reverse GCTGACCTTGAACTTCGTGC   
ICAM-1 Forward TGCAGCACCTCCTGTGACCA 25 60
  Reverse CAGTTCCACCCGTTCTGGAG   
E-Selectin Forward GGACTGCGTGGAGATCTACA 30 61
  Reverse AGCCAGGGTCACACTTGCAA   
N-Cadherin Forward GAAGGATGTGCATGAAGGAC 30 56
  Reverse AGTTAAGGTTGGCTTCAGGC   
GAPDH Forward GTCGTATTGGGCGCCTGGTCAC 15 60
  Reverse AGGGGCCATCCACAGTCTTCTG