Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 2 Primer sequences and annealing temperatures for copy number analysis by qPCR

From: Copy Number Amplification of the PIK3CA Gene Is Associated with Poor Prognosis in Non-lymph node metastatic Head and Neck Squamous Cell Carcinoma

Gene Primer sequence Tm,
PIK3CA F,5’- GCAAAGGTTGGTCGGTGAA -3’ 60
  R,5’- GTGATCTTTGATGTTACTCTGATGCA -3’  
KRAS F,5’- CACCCTAGACAAGCAGCCAATA -3’ 60
  R,5’- AAGCCCTGCCGCAAAAA -3’  
BRAF F,5’- CAAGTCACCACAAAAACCTATCGT -3’ 60
  R,5- AACTGACTCACCACTGTCCTCTGTT -3’  
  1. The copy number changes in KRAS, BRAF and PIK3CA were evaluated by qPCR. DNA from the normal tissue from each sample was used as the control; each gene copy number in the normal tissue was set as 2, and a copy number more than 4 was considered to be a gain.