Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 PCR production and sequence of primers and fluorescent probe

From: Cancer specific promoter CpG Islands hypermethylation of HOP homeobox (HOPX) gene and its potential tumor suppressive role in pancreatic carcinogenesis

Method Gene Forward primer (5>3) Fluorescent (53) Reverse primer (5>3)
bisulfite sequencing HOPX-β TAGTITTGTTTGGAAGAGGGGCG   AACCTCCCCTAAAAACAAACTTAAC
Q-MSP HOPX-β TTTGGAGAGGGTTTTAAAGCG FAM-CGGAGATAGAAGGTCGTTTATCGGGGAGGTCG-TAMRA AACAAACTTAACAAATCGCGAA
Q-MSP β-actin TGGTGATGGAGGAGGTTTAGTAAGT FAM-ACCACCACCCAACACACAATAACAAACACA-TAMRA AACCAATAAAACCTACTCCTCCCTTAA
RT-PCR§ HOPX-α and γ CAAACCCAGGGCTTGCGCTT   GCGGAGGAGCGAAACAGAGAT
RT-PCR§/Q-RT-PCR HOPX-β GGTCCCCCTTTCGGGAGGAA   GCGGAGGAGAGAAACAGAGAT
RT-PCR§/Q-RT-PCR HOPX-core CAGAGGACCAGGTGGAAATCC   GCGGAGGAGAGAAACAGAGAT
RT-PCR§/Q-RT-PCR β-actin GCTCGTCGTCGACAACGGCTC   CAAACATGATCTGGGTCATCTTCT
PCR for cloning# HOPX CACCATGTCGGCGGAGACCGCGAGCGG   GTCTGTGACGGATCTGACACTCTG
  1. Abbreviations: Tm, annealing temperature.
  2. : Bisulfite sequencing PCR was done at 95°C for 3 min followed by 40 cycles at 95°C for 1 min, 72°C for 2 min, and final extension at 72°C for 10 min,in a 50 μl reaction volume containing 1 μl treated DNA, 5 μl 10× PCR buffer, 0.2 μm ol/l MgCl2, 0.2 μmol/l each primer and 0.2 μl Platinum® Taq DNA Polymerase.
  3. ‡: Q-MSP was done at 95°C for 3 min followed by 45 cycles at 95°C for 20 sec, 60°C for 30 sec, and 72°C for 30 sec, in a 25 μl reaction volume containing 100 ng treated DNA, 300 nmol/l fluorescent probe, and 25 μl iQTM supermix.
  4. §: RT-PCR was done at 95°C for 3 min followed by 30 cycles at 95°C for 1 min, 60°C for 1 min, and final extension at 72°C for 1 min, and final extension at 72°C for 10 min, in a 50 μl reaction volume containing 1 μl cDNA, 5 μl 10× PCR buffer, 0.2 μmol/l dNTP mixture, 1.5 mmol/l MgCl2, 0.2 μm ol/l each primer and 0.2μl Platinum® Taq DNA Polymerase.
  5. : Q-RT-PCR was done at 95°C for 2 min followed by 40 cycle at 95°C for 15 sec, 60°C for 30 sec, and 72°C for 30 sec, in a 25 μl reaction volume containing 100 ng treated DNA, 300 nmol/l each primer, and 25 μl iQTMPCR Mix.
  6. #: PCR was done at 94°C for 2 min followed by 35 cycles at 94°C for 15 sec, 64.8°C for 15 sec, 68°C for 30 sec, and final extension at 68°C for 7 min, in a 50 μl reaction volume containing 1 μl cDNA, 5 μl 10× Pf×50TMPCR Mix, 0.3 μmol/l dNTP mixture, 0.3 μmol/l each primer and 1 μl Pf×50TM DNA Polymerase.