Skip to main content


Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 IDH primers

From: Three new chondrosarcoma cell lines: one grade III conventional central chondrosarcoma and two dedifferentiated chondrosarcomas of bone

Primer    Tm Product size
IDH1 genomic Forward CGGTCTTCAGAGAAGCCATT 59.4 113
IDH2 genomic Forward AACATCCACGCCTAGTCC 56.3 90
IDH2 genomic Reverse CAGTGGATCCCCTCTCCAC 60.5