Skip to main content

Advertisement

Table 1 IDH primers

From: Three new chondrosarcoma cell lines: one grade III conventional central chondrosarcoma and two dedifferentiated chondrosarcomas of bone

Primer    Tm Product size
IDH1 genomic Forward CGGTCTTCAGAGAAGCCATT 59.4 113
IDH1 genomic Reverse GCCAACATGACTTACTTGATCC 58.6  
IDH2 genomic Forward AACATCCACGCCTAGTCC 56.3 90
IDH2 genomic Reverse CAGTGGATCCCCTCTCCAC 60.5  
IDH1 cDNA Forward CGGTCTTCAGAGAAGCCATT 59.4 131
IDH1 cDNA Reverse AGGCCCAGGAACAACAAAAT 56.4  
IDH2 cDNA Forward AGTGTGGCTGCAAGTGTGC 60.0 365
IDH2 cDNA Reverse GAGATGGACTCGTCGGTGTT 60.1