Skip to main content

Table 1 Primers Used in Quantitative Reverse Transcriptase-Polymerase Chain Reaction analysis

From: Ephrin-A1 inhibits NSCLC tumor growth via induction of Cdx-2 a tumor suppressor gene

Gene Name Forward Primer (5'-3') Reverse Primer (5'-3')
Claudin-2 GACCCCTAAGGCTGAGGAAC AGAAGAGGAGGCCCAAGGAAG
Cdx-2 GCCAGGTCCTCTGAGAAGTG CCTCTGAGAGCCAGGTCTGT
Cdx-2-siRNA GACAAGGACGUGAGCAUGUACCCUA UAGGGUACAUGCUCACGUCCUUGUC
18srRNA AAACGGCTACCACATCCAAG TAACGAGGATCCATTGGAGG