Skip to main content

Advertisement

Table 1 Primer Sequences

From: Hornerin, an S100 family protein, is functional in breast cells and aberrantly expressed in breast cancer

Primer Species Sequence (5′- 3′) TM (°C)
Hornerin Human Forward: TTCGTCTTCCAGCTATGGTCAGCA 60
Reverse: AGTAACTTGAGCCAGACCCGTGTT
Hornerin Murine Forward: TCTCAACGGTTTGGATCTGGCTCA 60
Reverse: TGTTGACTGCCTTCTGTCTGTCCA
GAPDH Human/Murine Forward: CCCTCCATTGACCTCAACTAC 60
Reverse: CCACCTTCTTGATGTCATCAT